Počet záznamů: 1
G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly
- 1.
SYSNO ASEP 0554847 Druh ASEP J - Článek v odborném periodiku Zařazení RIV J - Článek v odborném periodiku Poddruh J Článek ve WOS Název G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly Tvůrce(i) Kejnovská, Iva (BFU-R) RID, ORCID
Stadlbauer, Petr (BFU-R) ORCID
Trantírek, L. (CZ)
Renčiuk, Daniel (BFU-R) RID, ORCID
Gajarský, M. (CZ)
Krafčík, D. (CZ)
Palacký, Jan (BFU-R) ORCID
Bednářová, Klára (BFU-R) ORCID
Šponer, Jiří (BFU-R) RID, ORCID
Mergny, Jean-Louis (BFU-R) ORCID, RID
Vorlíčková, Michaela (BFU-R) RID, ORCIDCelkový počet autorů 11 Zdroj.dok. Chemistry - A European Journal. - : Wiley - ISSN 0947-6539
Roč. 27, č. 47 (2021), s. 12115-12125Poč.str. 11 s. Forma vydání Tištěná - P Jazyk dok. eng - angličtina Země vyd. DE - Německo Klíč. slova amber force-field ; human telomere ; molecular-dynamics ; nucleic-acids ; k+ solution ; crystal-structure Vědní obor RIV CE - Biochemie Obor OECD Biochemistry and molecular biology CEP GA19-17063S GA ČR - Grantová agentura ČR GA20-20229S GA ČR - Grantová agentura ČR GA21-23718S GA ČR - Grantová agentura ČR EF15_003/0000477 GA MŠMT - Ministerstvo školství, mládeže a tělovýchovy Způsob publikování Omezený přístup Institucionální podpora BFU-R - RVO:68081707 UT WOS 000674838100001 EID SCOPUS 85110740007 DOI 10.1002/chem.202100895 Anotace Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally, however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes. Pracoviště Biofyzikální ústav Kontakt Jana Poláková, polakova@ibp.cz, Tel.: 541 517 244 Rok sběru 2022 Elektronická adresa https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895
Počet záznamů: 1