- G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Te…
Počet záznamů: 1  

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

  1. 1.
    SYSNO ASEP0554847
    Druh ASEPJ - Článek v odborném periodiku
    Zařazení RIVJ - Článek v odborném periodiku
    Poddruh JČlánek ve WOS
    NázevG-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly
    Tvůrce(i) Kejnovská, Iva (BFU-R) RID, ORCID
    Stadlbauer, Petr (BFU-R) ORCID
    Trantírek, L. (CZ)
    Renčiuk, Daniel (BFU-R) RID, ORCID
    Gajarský, M. (CZ)
    Krafčík, D. (CZ)
    Palacký, Jan (BFU-R) ORCID
    Bednářová, Klára (BFU-R) ORCID
    Šponer, Jiří (BFU-R) RID, ORCID
    Mergny, Jean-Louis (BFU-R) ORCID, RID
    Vorlíčková, Michaela (BFU-R) RID, ORCID
    Celkový počet autorů11
    Zdroj.dok.Chemistry - A European Journal. - : Wiley - ISSN 0947-6539
    Roč. 27, č. 47 (2021), s. 12115-12125
    Poč.str.11 s.
    Forma vydáníTištěná - P
    Jazyk dok.eng - angličtina
    Země vyd.DE - Německo
    Klíč. slovaamber force-field ; human telomere ; molecular-dynamics ; nucleic-acids ; k+ solution ; crystal-structure
    Vědní obor RIVCE - Biochemie
    Obor OECDBiochemistry and molecular biology
    CEPGA19-17063S GA ČR - Grantová agentura ČR
    GA20-20229S GA ČR - Grantová agentura ČR
    GA21-23718S GA ČR - Grantová agentura ČR
    EF15_003/0000477 GA MŠMT - Ministerstvo školství, mládeže a tělovýchovy
    Způsob publikováníOmezený přístup
    Institucionální podporaBFU-R - RVO:68081707
    UT WOS000674838100001
    EID SCOPUS85110740007
    DOI https://doi.org/10.1002/chem.202100895
    AnotaceGuanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally, however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
    PracovištěBiofyzikální ústav
    KontaktJana Poláková, polakova@ibp.cz, Tel.: 541 517 244
    Rok sběru2022
    Elektronická adresahttps://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895
Počet záznamů: 1  

  Tyto stránky využívají soubory cookies, které usnadňují jejich prohlížení. Další informace o tom jak používáme cookies.