First report of strawberry crinivirus 3 and strawberry crinivirus 4 in strawberry in Iran

0559964 - BC 2023 RIV DE eng O - Ostatní výsledky
Hajizadeh, M. - Zandan, N. G. - Kashiha, Z. - Koloniuk, Igor
First report of strawberry crinivirus 3 and strawberry crinivirus 4 in strawberry in Iran.
2022. Journal of Plant Pathology. Roč. 104, č. 2 (2022), s. 825-825. ISSN 1125-4653. E-ISSN 2239-7264
Institucionální podpora: RVO:60077344
Klíčová slova: SCrV-3 * SCrV-4 * rt-pcr * Strawberry * Viral disease
Obor OECD: Virology
https://link.springer.com/article/10.1007/s42161-022-01035-z

In Iran, strawberry (Fragaria × ananassa) is grown in two main regions in the west (Kurdistan Province) and north (Mazandaran, Guilan and Golestan Provinces) of the country. Criniviruses emerged as a major agricultural threat worldwide among strawberries. To monitor two criniviruses, strawberry crinivirus 3 (SCrV-3) and strawberry crinivirus 4 (SCrV-4), 23 strawberry plants showing virus-like symptoms were collected from commercial fields in the west and north of Iran and subjected to RT-PCR. Total RNA was extracted using a silica-capture method, cDNA was synthesized and PCRs were conducted using SCrV3mF (5- TTGTCATAAGGAGGCACAGC -3′) and SCrV3mR (5ʹ- GCTCTTGTCATAGGCACGAA -3′) (this work), and SCrV4f1 (5ʹ- CCAATTCTGATCCTATCCTTAGT -3′) (Chen et al. 2018) and SCrV4mR1 (5ʹ- AGGCGCGAAATCCAAACTTC -3ʹ) (this work) designed from conserved partial virus sequences available in GenBank. Expected RT-PCR products of ~ 673 bp and ~1362 bp in size were obtained from 11 and four samples for SCrV-3 and SCrV-4, respectively, and sequenced. SCrV-3 was detected in samples from both regions, whereas SCrV-4 was detected only from western Iran, suggesting that SCrV-4 may not be evenly distributed in Iran. Nucleotide BLAST analysis confirmed that the two sequences belonged to SCrV-3 and SCrV-4 and were submitted to GenBank as accession numbers OL631153 and MZ868643, respectively. The SCrV-3 sequence shared 98.6% nucleotide identity with the 1a coding region of isolate M1 of SCrV-3 (EU267168) from Maryland, USA. The Iranian SCrV-4 isolate shared 82.4% nucleotide sequence identity with the 1a coding region of isolate B1156-M3 of SCrV-4 (EU490423) from Maryland, USA. Both SCrV-3 and SCrV-4 have been reported so far in North America (Ding et al. 2016, Diaz-Lara et al. 2021) and China (Chen et al. 2018). To our knowledge, this is the first report of SCrV-3 and SCrV-4 infecting strawberries in Iran.
Trvalý link: https://hdl.handle.net/11104/0340246