Number of the records: 1

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

SYSNO ASEP	0554847
Document Type	J - Journal Article
R&D Document Type	Journal Article
Subsidiary J	Článek ve WOS
Title	G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly
Author(s)	Kejnovská, Iva (BFU-R)_{RID, ORCID} Stadlbauer, Petr (BFU-R)_ORCID Trantírek, L. (CZ) Renčiuk, Daniel (BFU-R)_{RID, ORCID} Gajarský, M. (CZ) Krafčík, D. (CZ) Palacký, Jan (BFU-R)_ORCID Bednářová, Klára (BFU-R)_ORCID Šponer, Jiří (BFU-R)_{RID, ORCID} Mergny, Jean-Louis (BFU-R)_{ORCID, RID} Vorlíčková, Michaela (BFU-R)_{RID, ORCID}
Number of authors	11
Source Title	Chemistry - A European Journal. - : Wiley - ISSN 0947-6539 Roč. 27, č. 47 (2021), s. 12115-12125
Number of pages	11 s.
Publication form	Print - P
Language	eng - English
Country	DE - Germany
Keywords	amber force-field ; human telomere ; molecular-dynamics ; nucleic-acids ; k+ solution ; crystal-structure
Subject RIV	CE - Biochemistry
OECD category	Biochemistry and molecular biology
R&D Projects	GA19-17063S GA ČR - Czech Science Foundation (CSF)
	GA20-20229S GA ČR - Czech Science Foundation (CSF)
	GA21-23718S GA ČR - Czech Science Foundation (CSF)
	EF15_003/0000477 GA MŠMT - Ministry of Education, Youth and Sports (MEYS)
Method of publishing	Limited access
Institutional support	BFU-R - RVO:68081707
UT WOS	000674838100001
EID SCOPUS	85110740007
DOI	10.1002/chem.202100895
Annotation	Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally, however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Workplace	Institute of Biophysics
Contact	Jana Poláková, polakova@ibp.cz, Tel.: 541 517 244
Year of Publishing	2022
Electronic address	https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895

Number of the records: 1