Number of the records: 1  

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

  1. 1.
    0569719 - BFÚ 2024 RIV NL eng J - Journal Article
    Legartová, Soňa - Fagherazzi, Paolo - Goswami, Pratik - Brázda, Václav - Lochmanová, G. - Koutná, I. - Bártová, Eva
    Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.
    Biochimie. Roč. 204, č. 2023 (2023), s. 154-168. ISSN 0300-9084. E-ISSN 1638-6183
    Grant - others:AV ČR(CZ) StrategieAV21/7
    Institutional support: RVO:68081707
    Keywords : p53 * 53bp1 * DNA damage * Epigenetics * Mass spectrometry * flim-fret * afm
    OECD category: Biochemistry and molecular biology
    Impact factor: 3.9, year: 2022
    Method of publishing: Limited access
    https://www.sciencedirect.com/science/article/abs/pii/S0300908422002498?via%3Dihub

    An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction be-tween 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and y-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphory-lated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to y-radiation, while y-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by y-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that y-irradiation, in general, strengthens the binding of phos-phorylated p53 protein to the encoding gene.(c) 2022 Elsevier B.V. and Societe Francaise de Biochimie et Biologie Moleculaire (SFBBM). All rights reserved.
    Permanent Link: https://hdl.handle.net/11104/0344343

     
     
Number of the records: 1  

  This site uses cookies to make them easier to browse. Learn more about how we use cookies.